View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-11 (Length: 147)
Name: Solexa-NF5676-11
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 6 - 144
Target Start/End: Complemental strand, 10794817 - 10794679
Alignment:
| Q |
6 |
caggtagttatgacatcttcagcagctttgcggataaacaatcttcgacgacactttgattcggatagcacagtcaacaaggtacgaaatatgaatttct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10794817 |
caggtagttatgacatcttcagcagctttgcggataaacaatattcgacgacactttgattcggataacacagtcaacaaggtacgaaatatgaatttct |
10794718 |
T |
 |
| Q |
106 |
cacataacaatcattaacatttgttgcaaatctgtttgt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10794717 |
cacataacaatcattaacatttgttgcaaatctttttgt |
10794679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University