View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-12 (Length: 125)
Name: Solexa-NF5676-12
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 44598477 - 44598360
Alignment:
| Q |
8 |
gtttgtattttggtgggtggttgtttgtttctttgttgggtatttaggcatctgagggaattatttgccatcgatcctgcggattacatgcttgctattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44598477 |
gtttgtattttggtgggtggttgtttgtttctttgttgggtatttaggcatctgagggaattatttgctatcgatcctgcggattacatgcttgctattt |
44598378 |
T |
|
| Q |
108 |
gtggcaatgatacattga |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44598377 |
gtggcaatgatacattga |
44598360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 48 - 118
Target Start/End: Complemental strand, 39806577 - 39806507
Alignment:
| Q |
48 |
tatttaggcatctgagggaattatttgccatcgatcctgcggattacatgcttgctatttgtggcaatgat |
118 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
39806577 |
tatttagacatctaagggaattatttgccatagatcctgcggattacatgcatgctatttgtggaaatgat |
39806507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University