View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5676-12 (Length: 125)

Name: Solexa-NF5676-12
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5676-12
Solexa-NF5676-12
[»] chr3 (1 HSPs)
chr3 (8-125)||(44598360-44598477)
[»] chr8 (1 HSPs)
chr8 (48-118)||(39806507-39806577)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 44598477 - 44598360
Alignment:
8 gtttgtattttggtgggtggttgtttgtttctttgttgggtatttaggcatctgagggaattatttgccatcgatcctgcggattacatgcttgctattt 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
44598477 gtttgtattttggtgggtggttgtttgtttctttgttgggtatttaggcatctgagggaattatttgctatcgatcctgcggattacatgcttgctattt 44598378  T
108 gtggcaatgatacattga 125  Q
    ||||||||||||||||||    
44598377 gtggcaatgatacattga 44598360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 48 - 118
Target Start/End: Complemental strand, 39806577 - 39806507
Alignment:
48 tatttaggcatctgagggaattatttgccatcgatcctgcggattacatgcttgctatttgtggcaatgat 118  Q
    ||||||| ||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||    
39806577 tatttagacatctaagggaattatttgccatagatcctgcggattacatgcatgctatttgtggaaatgat 39806507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University