View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-14 (Length: 146)
Name: Solexa-NF5676-14
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 56319783 - 56319651
Alignment:
| Q |
7 |
acttagcaaatcaaaggagtatatatctaccattgatttggctcctctaaaatgaatagtagttagtaacgaactatatttattcactgagagttggctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56319783 |
acttagcaaatcaaaggagtatatatctaccattgatttggctcctctaaaatgaatagtagttagtaacgaactatatttattcactgagagttggctc |
56319684 |
T |
 |
| Q |
107 |
ggatggaagcattgatctttattcacttaaaaa |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
56319683 |
ggatggagtcattgatctttattcacttaaaaa |
56319651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University