View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-15 (Length: 121)
Name: Solexa-NF5676-15
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 2e-51
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 36717049 - 36716948
Alignment:
| Q |
13 |
agcagagaatgaagatggatcagagaaaatggtcagctggttagcatgaactggtgttccagtttgctcaatttcctcagttccctgtctctccctcctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36717049 |
agcagagaatgaagatggatcagagaaaatggtcagctggttagcatgaactggtgttccagtttgctcaatttcctcagttccctgtctctccctcctt |
36716950 |
T |
|
| Q |
113 |
ct |
114 |
Q |
| |
|
|| |
|
|
| T |
36716949 |
ct |
36716948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 1e-46
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 1482261 - 1482160
Alignment:
| Q |
13 |
agcagagaatgaagatggatcagagaaaatggtcagctggttagcatgaactggtgttccagtttgctcaatttcctcagttccctgtctctccctcctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
1482261 |
agcagagaatgaagatggatcagagaaaatggtcagctggttagcatgaactggtgttccagtttgctcaatctcctcagttcccagtctctccctcctt |
1482162 |
T |
|
| Q |
113 |
ct |
114 |
Q |
| |
|
|| |
|
|
| T |
1482161 |
ct |
1482160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University