View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5676-2 (Length: 219)

Name: Solexa-NF5676-2
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5676-2
Solexa-NF5676-2
[»] chr4 (2 HSPs)
chr4 (59-219)||(56318888-56319051)
chr4 (9-48)||(56318891-56318930)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 59 - 219
Target Start/End: Original strand, 56318888 - 56319051
Alignment:
59 catagggtggaaaaagtaatagtctattattcgtgacatttaatcccagcaaaatttgaatttagtc--tctctttttgttgtagatagataaaatgaca 156  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||  | | |||||||||||||||||||||||||||    
56318888 catagggtgggaaaagtaatagtctattattcgtgacatttaatcccaacaaaatttgaatttagtctttttttttttgttgtagatagataaaatgaca 56318987  T
157 ataatcattagaaattcactggaattagaa-ctcgatgatcacatcgtctcatttgtggactat 219  Q
    ||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||    
56318988 ataatcattagaaattcacaggaattagaacctcgatgatcacatcgtctgatttgtggactat 56319051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 56318891 - 56318930
Alignment:
9 agggtggaaaaagtaatagtctattattcgtgacatttaa 48  Q
    ||||||| ||||||||||||||||||||||||||||||||    
56318891 agggtgggaaaagtaatagtctattattcgtgacatttaa 56318930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University