View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-2 (Length: 219)
Name: Solexa-NF5676-2
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-2 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 59 - 219
Target Start/End: Original strand, 56318888 - 56319051
Alignment:
| Q |
59 |
catagggtggaaaaagtaatagtctattattcgtgacatttaatcccagcaaaatttgaatttagtc--tctctttttgttgtagatagataaaatgaca |
156 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
56318888 |
catagggtgggaaaagtaatagtctattattcgtgacatttaatcccaacaaaatttgaatttagtctttttttttttgttgtagatagataaaatgaca |
56318987 |
T |
 |
| Q |
157 |
ataatcattagaaattcactggaattagaa-ctcgatgatcacatcgtctcatttgtggactat |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
56318988 |
ataatcattagaaattcacaggaattagaacctcgatgatcacatcgtctgatttgtggactat |
56319051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 56318891 - 56318930
Alignment:
| Q |
9 |
agggtggaaaaagtaatagtctattattcgtgacatttaa |
48 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
56318891 |
agggtgggaaaagtaatagtctattattcgtgacatttaa |
56318930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University