View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-23 (Length: 143)
Name: Solexa-NF5676-23
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-23 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 44597827 - 44597969
Alignment:
| Q |
1 |
gagatgaacctttgaggtcaaatcgcttatgaattcgatactccgaacaaaacacattgcccattacaataaatcgagtctgtttttccatagcaataca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44597827 |
gagatgaacctttgaggtcaaatcgcttatgaattcgatactccgaacaaaacacattgcccattacaataaatcgagtctgtttttccatagcaataca |
44597926 |
T |
|
| Q |
101 |
agtattcatttatattattactaacattcatatagcacatcag |
143 |
Q |
| |
|
||||||| ||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
44597927 |
agtattcgtttatattattacaagcattcatatagtacatcag |
44597969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 39806011 - 39806097
Alignment:
| Q |
1 |
gagatgaacctttgaggtcaaatcgcttatgaattcgatactccgaacaaaacacattgcccattacaataaatcgagtctgttttt |
87 |
Q |
| |
|
|||| ||||||||||| ||||| | ||||| |||||||||||||||||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
39806011 |
gagaagaacctttgagatcaaaccttttatggattcgatactccgaacaaaacacattgcccatcacaataaaccgaatctgttttt |
39806097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University