View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-29 (Length: 151)
Name: Solexa-NF5676-29
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 2e-61
Query Start/End: Original strand, 33 - 151
Target Start/End: Original strand, 10794422 - 10794540
Alignment:
| Q |
33 |
tacgaaaagatatataataccatgtgaaatgatggtagattccagagcaacaactgcacgtcctagtgataacgcttcagaaacctctgaagctaccttc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794422 |
tacgaaaagatatataataccatgtgaaatgatggtagattccagagcaacaactgcacgtcctagtgataacgcttcagaaacctctgaagctaccttc |
10794521 |
T |
|
| Q |
133 |
acattgattgacgaagctc |
151 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10794522 |
acattgattgacgaagctc |
10794540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University