View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-34 (Length: 130)
Name: Solexa-NF5676-34
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-34 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 35 - 130
Target Start/End: Complemental strand, 12342658 - 12342563
Alignment:
| Q |
35 |
tacaaattaaaatcttctaatcaactttgttttcattcatcatcttctcagcacataacggcagaggcatggcggcacatcattgtttacatgcat |
130 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
12342658 |
tacaaattaaattcttctaatcaactttgttttcattcatcatcttctcagcacataacggcagaggcatggcggcaaatcataatttacaggcat |
12342563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University