View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-35 (Length: 141)
Name: Solexa-NF5676-35
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 7 - 141
Target Start/End: Original strand, 14532308 - 14532442
Alignment:
| Q |
7 |
catagacaggagcaatgcggttgaaaagcgcctgtcggtcgttagagtagcgaatggaagtcggtcggaatgaaggataaggagcaaccgccgggaacat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14532308 |
catagacaggagcaatgcggttgaaaagcgcctgtcggtcgttagagcagcgaatggaagtcggtcggtatgaaggataaggagcaaccgccgggaacat |
14532407 |
T |
 |
| Q |
107 |
ctctgccacacaacattcacaactctcacgtgtca |
141 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
14532408 |
ctctgcaacacaacattcacaactctcacgtgtca |
14532442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University