View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-40 (Length: 127)
Name: Solexa-NF5676-40
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 96 - 127
Target Start/End: Complemental strand, 51725863 - 51725832
Alignment:
| Q |
96 |
gtaagtttattattagattaaataaatataat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51725863 |
gtaagtttattattagattaaataaatataat |
51725832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University