View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-44 (Length: 124)
Name: Solexa-NF5676-44
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-44 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 10 - 124
Target Start/End: Complemental strand, 2515482 - 2515368
Alignment:
| Q |
10 |
ttgcaactaaatgatgatgctttcatttgatttttgtgttgaatgacaatccctctttatatggccttttgcaacaatctttctgcattttaacgtggat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2515482 |
ttgcaactaaatgatgatgctttcatttgatttttgtgttgaatgacaatccctctttatatagccttttgcaacaatctttctgcattttaacgtggat |
2515383 |
T |
|
| Q |
110 |
tgtaattgcatgttt |
124 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2515382 |
tgtaattgcatgttt |
2515368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 25 - 80
Target Start/End: Complemental strand, 2511862 - 2511805
Alignment:
| Q |
25 |
gatgctttcatttgattttt--gtgttgaatgacaatccctctttatatggccttttg |
80 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||||| |||||||||||| |
|
|
| T |
2511862 |
gatgctttcatttgatttttttgtgttgaataacaagccctctttgtatggccttttg |
2511805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University