View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-45 (Length: 157)
Name: Solexa-NF5676-45
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 11 - 154
Target Start/End: Original strand, 33016015 - 33016158
Alignment:
| Q |
11 |
agagaacagaagcgagttgatcactttgaatcagcaacagactgagctgattccaaaatatccagcttctgcagattgatacagcaaggccgcaagagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33016015 |
agagaacagaagcgagttgatcactttgaatcagcaacagactgagctgattccaaaatatccagcttctgcagattgatacagcaaggccgcaagagaa |
33016114 |
T |
|
| Q |
111 |
aagaatgtggctggagctttcgttttctgcatcaccgttaacac |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33016115 |
aagaatgtggctggagctttcgttttctgcatcacggttaacac |
33016158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University