View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-46 (Length: 123)
Name: Solexa-NF5676-46
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 8e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 38 - 114
Target Start/End: Complemental strand, 33016527 - 33016451
Alignment:
| Q |
38 |
attggatttataaatgattgtacttggagccgagttcaatattggagttctaaatgtctttgtagagcgggaaacaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33016527 |
attggatttataaatgattgtacttggagccgagttcaatattggagttctaaatgtctttgtagagcgggtaacaa |
33016451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University