View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-47 (Length: 138)
Name: Solexa-NF5676-47
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 9e-57
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 48152503 - 48152640
Alignment:
| Q |
1 |
cagagagaggggtttatgtaggagtttatggttttctttagtctggtactgttgtggaagatgnnnnnnnttggttcatggygataaagagattctcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
48152503 |
cagagagaggggtttatgtaggagtttatggttttctttagtctggtactgttgtggaagatgaaaaaaattggttcatggtgataaagagattctcata |
48152602 |
T |
 |
| Q |
101 |
tttgttttgtatctctcataaattatagggatgagtcg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48152603 |
tttgttttgtatctctcataaattatagggctgagtcg |
48152640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 63
Target Start/End: Original strand, 10292282 - 10292339
Alignment:
| Q |
6 |
agaggggtttatgtaggagtttatggttttctttagtctggtactgttgtggaagatg |
63 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| |||||| ||| ||||| ||||||| |
|
|
| T |
10292282 |
agagaggtttatgtaggaatttatggttttcttcagtctgataccgttgtagaagatg |
10292339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University