View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5676-47 (Length: 138)

Name: Solexa-NF5676-47
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5676-47
Solexa-NF5676-47
[»] chr1 (1 HSPs)
chr1 (1-138)||(48152503-48152640)
[»] chr8 (1 HSPs)
chr8 (6-63)||(10292282-10292339)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 9e-57
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 48152503 - 48152640
Alignment:
1 cagagagaggggtttatgtaggagtttatggttttctttagtctggtactgttgtggaagatgnnnnnnnttggttcatggygataaagagattctcata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||| ||||||||||||||||||    
48152503 cagagagaggggtttatgtaggagtttatggttttctttagtctggtactgttgtggaagatgaaaaaaattggttcatggtgataaagagattctcata 48152602  T
101 tttgttttgtatctctcataaattatagggatgagtcg 138  Q
    |||||||||||||||||||||||||||||| |||||||    
48152603 tttgttttgtatctctcataaattatagggctgagtcg 48152640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 63
Target Start/End: Original strand, 10292282 - 10292339
Alignment:
6 agaggggtttatgtaggagtttatggttttctttagtctggtactgttgtggaagatg 63  Q
    |||| ||||||||||||| |||||||||||||| |||||| ||| ||||| |||||||    
10292282 agagaggtttatgtaggaatttatggttttcttcagtctgataccgttgtagaagatg 10292339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University