View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-51 (Length: 130)
Name: Solexa-NF5676-51
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-51 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 61 - 130
Target Start/End: Original strand, 14532874 - 14532942
Alignment:
| Q |
61 |
aattagaaagttatgttggaaggtaggttatagaaaaatttatgtgtttcttgaactttctttaatatgg |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
14532874 |
aattagaaagttatgttggaaggtaggttatag-aaaacttatgtgtttctcgaactttctttaatatgg |
14532942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 4 - 58
Target Start/End: Complemental strand, 28527254 - 28527200
Alignment:
| Q |
4 |
aggggtgtacaattaagggtgtctacctatcattgctcataattttaaggttcat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28527254 |
aggggtgtacaattaagggtgtctacctatcattgctcataattttaagattcat |
28527200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University