View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-55 (Length: 139)
Name: Solexa-NF5676-55
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 30 - 138
Target Start/End: Original strand, 4795352 - 4795460
Alignment:
| Q |
30 |
taatacacactaatttaattcatagagtacaaaataagaatattcaaatcattaaatacatctgactatgaatttgtcaatcgtctgcatgcatatggtg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
4795352 |
taatacacactaatttaattcatagagtacaaaataagaacattcaaatcattaaatacatctgactatgaatttgtcattcgtctgcatgcatatgttg |
4795451 |
T |
 |
| Q |
130 |
gattactta |
138 |
Q |
| |
|
||||||||| |
|
|
| T |
4795452 |
gattactta |
4795460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University