View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-62 (Length: 108)
Name: Solexa-NF5676-62
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-62 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 14 - 108
Target Start/End: Original strand, 45787141 - 45787235
Alignment:
| Q |
14 |
gaaccgatcaccgtcgtaccggatccaattctgaacagctttttcaacggtgcgttcacggtgagggacactagcataccaagcaccatccctac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
45787141 |
gaaccgatcaccgtcgtaccggatccaattctgaacagctttttcaacagtgagttcacggtgagggacattagcataccaagcaacatccctac |
45787235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University