View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5676-9 (Length: 120)

Name: Solexa-NF5676-9
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5676-9
Solexa-NF5676-9
[»] chr5 (1 HSPs)
chr5 (50-114)||(21358534-21358598)
[»] chr6 (1 HSPs)
chr6 (8-50)||(20022946-20022988)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 1e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 50 - 114
Target Start/End: Original strand, 21358534 - 21358598
Alignment:
50 tcggaatcattaacattctgaacaagagcttgcttcccttcatcttgagacccgacccaaccctc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
21358534 tcggaatcattaacattctgaacaagagcttgcttcccttcatcttgagacccaacccaaccctc 21358598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 20022988 - 20022946
Alignment:
8 agacgaccactacatcccccttttgccgatgcttcatctcact 50  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
20022988 agacgaccactacatcccccttttgccgatgctttatctcact 20022946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University