View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-1 (Length: 144)
Name: Solexa-NF5680-1
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 8 - 144
Target Start/End: Original strand, 3685914 - 3686058
Alignment:
| Q |
8 |
ccccctatgaacactgataagtctatcacat--------ttagcactacaaactgtcacatatgagattgagagaacaacaaatactgagaaaaaattcc |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685914 |
ccccttatgaacactgataagtctatcacatcttttcatttagcgctacaaaatgtcacatatgagattgagagaacaacaaatactgagaaaaaattcc |
3686013 |
T |
|
| Q |
100 |
cgagtttggaattgataaccgttaatgcacatatggatgcttcag |
144 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3686014 |
cgagtttggaattggtaaccgttaatgaacatatggatgcttcag |
3686058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University