View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-14 (Length: 151)
Name: Solexa-NF5680-14
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-14 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 14 - 151
Target Start/End: Original strand, 31909976 - 31910113
Alignment:
| Q |
14 |
gaacaaaggagtgtggcactccacaagtggtgtctagaattatgcaagactgtatctgaaaatgagactgaactttactttgaattcatcttgcatagtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31909976 |
gaacaaaggagtgtggcactccacaagtggtgtctagaattatgcaagactgtatctgaaaatgagactgaacttcactttgaattcatcttgcatagtt |
31910075 |
T |
|
| Q |
114 |
ttttgctttcgttcacacttaaaattttatcatctgtt |
151 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31910076 |
tttcgctttcgttcacacttaaaattttatcatctgtt |
31910113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 14 - 49
Target Start/End: Original strand, 31901352 - 31901387
Alignment:
| Q |
14 |
gaacaaaggagtgtggcactccacaagtggtgtcta |
49 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31901352 |
gaacaaagaagtgtggcactccacaagtggtgtcta |
31901387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University