View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-21 (Length: 169)
Name: Solexa-NF5680-21
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 4e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 4e-55
Query Start/End: Original strand, 33 - 169
Target Start/End: Original strand, 45512262 - 45512398
Alignment:
| Q |
33 |
caatagaaacacagagagaaagcatgggaagatattacaaacgtgtagtgcttttggtgttgattgaaattgcacaaatatgcttgtgtgtaaattcaaa |
132 |
Q |
| |
|
||||||||||| ||| ||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512262 |
caatagaaacagagatagaaaacatgggaagatattacaaatgtgtagtacttttggtgttgattgaaattgcacaaatatgcttgtgtgtaaattcaaa |
45512361 |
T |
|
| Q |
133 |
catcccctgcgttgaaaaagagaggcaagcccttctc |
169 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45512362 |
catcccctgtattgaaaaagagaggcaagcccttctc |
45512398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University