View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-26 (Length: 127)
Name: Solexa-NF5680-26
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-26 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 3686206 - 3686081
Alignment:
| Q |
1 |
ctgcttcttcgtcagataataagatattcgtttacaagatcaagttccctctgaagttgcggacaaatgattgcaatggacgaagaatgaccaatagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3686206 |
ctgcttcttcgtcagataataagatattcgtttacaagatcaagttccttctgaagttgcagacaaatgattgcaatggacgaagaatgaccaatagaag |
3686107 |
T |
|
| Q |
101 |
ctttagcatttgaattctgcgctatca |
127 |
Q |
| |
|
||||| || |||| ||||||||||||| |
|
|
| T |
3686106 |
ctttaaca-ttgacttctgcgctatca |
3686081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 14144298 - 14144348
Alignment:
| Q |
18 |
aataagatattcgtttacaagatcaagttccctctgaagttgcggacaaat |
68 |
Q |
| |
|
||||||||||||| | ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14144298 |
aataagatattcgctaacaagatcaagttccttttgaagttgcggacaaat |
14144348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University