View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-29 (Length: 127)
Name: Solexa-NF5680-29
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 48277158 - 48277262
Alignment:
| Q |
8 |
attttgtcgttgatattcctctaaaatcactagttttagtcatatcatttatttgtacaaataaatagaataaaatttcttttatagttaaacaaaatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277158 |
attttgtcgttgatattcctctaaaatcactagttttagtcatatcatttatttgtacaaataaatagaataaaatttcttttatagttaaacaaaatta |
48277257 |
T |
|
| Q |
108 |
gagta |
112 |
Q |
| |
|
||||| |
|
|
| T |
48277258 |
gagta |
48277262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University