View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5680-31 (Length: 127)

Name: Solexa-NF5680-31
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5680-31
Solexa-NF5680-31
[»] chr8 (2 HSPs)
chr8 (8-127)||(31910298-31910417)
chr8 (40-122)||(31902967-31903049)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 1e-54; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 31910417 - 31910298
Alignment:
8 taaaatttgtgaaagagtgtaatagagattgagattgaatgaaaaatgtgatctgttgcggaccacggtccactttagcaggtcccataattctatgcta 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||    
31910417 taaaatttgtgaaagagtgtaatagagattgagattgaatgaaaaatgtgatctgttgcggaccacggtccattttagcagctcccacaattctatgcta 31910318  T
108 gcaaacatcatagataagtt 127  Q
    ||||||||||||||||||||    
31910317 gcaaacatcatagataagtt 31910298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 40 - 122
Target Start/End: Complemental strand, 31903049 - 31902967
Alignment:
40 gattgaatgaaaaatgtgatctgttgcggaccacggtccactttagcaggtcccataattctatgctagcaaacatcatagat 122  Q
    ||||||||||| |||| ||||||||| |||||| |||||| |||||  | |||||  ||||||||||||||||||||||||||    
31903049 gattgaatgaataatgcgatctgttgtggaccatggtccattttagtcgttcccaggattctatgctagcaaacatcatagat 31902967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University