View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-31 (Length: 127)
Name: Solexa-NF5680-31
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-31 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 1e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 31910417 - 31910298
Alignment:
| Q |
8 |
taaaatttgtgaaagagtgtaatagagattgagattgaatgaaaaatgtgatctgttgcggaccacggtccactttagcaggtcccataattctatgcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
31910417 |
taaaatttgtgaaagagtgtaatagagattgagattgaatgaaaaatgtgatctgttgcggaccacggtccattttagcagctcccacaattctatgcta |
31910318 |
T |
 |
| Q |
108 |
gcaaacatcatagataagtt |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31910317 |
gcaaacatcatagataagtt |
31910298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 40 - 122
Target Start/End: Complemental strand, 31903049 - 31902967
Alignment:
| Q |
40 |
gattgaatgaaaaatgtgatctgttgcggaccacggtccactttagcaggtcccataattctatgctagcaaacatcatagat |
122 |
Q |
| |
|
||||||||||| |||| ||||||||| |||||| |||||| ||||| | ||||| |||||||||||||||||||||||||| |
|
|
| T |
31903049 |
gattgaatgaataatgcgatctgttgtggaccatggtccattttagtcgttcccaggattctatgctagcaaacatcatagat |
31902967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University