View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-33 (Length: 137)
Name: Solexa-NF5680-33
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-33 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 1e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 82 - 137
Target Start/End: Complemental strand, 4179716 - 4179661
Alignment:
| Q |
82 |
taattactagttttaggttttattgttcttactattaaccgtgtaagtaagtgctt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4179716 |
taattactagttttaggttttattgttcttactattaaccgtgtaagtaagtgctt |
4179661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 4179759 - 4179708
Alignment:
| Q |
8 |
gtgacaacatgacattttggtataacttacaaagttaaaataataattacta |
59 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4179759 |
gtgacaacatgacattttgatataacttacaaagttaaaataataattacta |
4179708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University