View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-36 (Length: 76)
Name: Solexa-NF5680-36
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 25651969 - 25651908
Alignment:
| Q |
8 |
actcacaatcacaatcattttgtgtctcaaccaaacactcacaatcatcttgtctatggtac |
69 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
25651969 |
actcaaaatcacaatcattttgtgtctcaaccaaacactcacaatcatcttgtgtgtggtac |
25651908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 60
Target Start/End: Original strand, 34313900 - 34313934
Alignment:
| Q |
26 |
tttgtgtctcaaccaaacactcacaatcatcttgt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
34313900 |
tttgtgtctcaaccaaacactcacaatcattttgt |
34313934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University