View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-37 (Length: 95)
Name: Solexa-NF5680-37
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-37 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 10661924 - 10661837
Alignment:
| Q |
8 |
ttaggatgttatgaattatatatttaactaaacttgaagtggcaattttaattttcaggtttttaatacaatttttatgtagatatgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||| |
|
|
| T |
10661924 |
ttaggatgttatgaattatatatttaactaaacttgaagtggcaattttaattttcaggattttaatacaatttctatgtagctatgt |
10661837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University