View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5680-39 (Length: 97)
Name: Solexa-NF5680-39
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5680-39 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 5e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 352804 - 352900
Alignment:
| Q |
1 |
gagaagaatacagaatccatgaatgtgttgcttgatactctttgcaaagrgaaatttgttgaacaagctcgcgaaacttacttggagctgaagcatt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
352804 |
gagaagaatacagaatccatgaatgtgttgcttgatactctttgcaaagagaaatttgttgaacaagctcgcgaaatttacttggagctgaagcatt |
352900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 8e-38
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 10579584 - 10579680
Alignment:
| Q |
1 |
gagaagaatacagaatccatgaatgtgttgcttgatactctttgcaaagrgaaatttgttgaacaagctcgcgaaacttacttggagctgaagcatt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
10579584 |
gagaagaatacagaatccatgaatgtgttgcttgatactctatgtaaagagaaatttgttgaacaagctcgtgaaatttacttggagctgaagcatt |
10579680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 87; Significance: 1e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-42
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 24577991 - 24578087
Alignment:
| Q |
1 |
gagaagaatacagaatccatgaatgtgttgcttgatactctttgcaaagrgaaatttgttgaacaagctcgcgaaacttacttggagctgaagcatt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24577991 |
gagaagaatacagaatccatgaatgtgttgcttgatactctttgcaaagaaaaatttgttgaacaagctcgcgaaatttacttggagctgaagcatt |
24578087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University