View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5682-10 (Length: 154)
Name: Solexa-NF5682-10
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5682-10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 2e-47; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 3250974 - 3250879
Alignment:
| Q |
8 |
ataaataccctttatcctttactcttagtcacagtctaagtaagtgcatgcactccaaacacattggttccttaaaccattttatgctttcctatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3250974 |
ataaataccctttatcctttactcttagtcacagtctaagtaagtgcatgcactccaaacacattggttccttaaaccattttatgctttcctatg |
3250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 48 - 87
Target Start/End: Complemental strand, 3271523 - 3271484
Alignment:
| Q |
48 |
taagtgcatgcactccaaacacattggttccttaaaccat |
87 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3271523 |
taagtgcatctactccaaacacattggttccttaaaccat |
3271484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 48 - 87
Target Start/End: Complemental strand, 3285034 - 3284995
Alignment:
| Q |
48 |
taagtgcatgcactccaaacacattggttccttaaaccat |
87 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3285034 |
taagtgcatctactccaaacacattggttccttaaaccat |
3284995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 61 - 96
Target Start/End: Complemental strand, 3257127 - 3257092
Alignment:
| Q |
61 |
tccaaacacattggttccttaaaccattttatgctt |
96 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3257127 |
tccaaacaccttgattccttaaaccattttatgctt |
3257092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 3288136 - 3288093
Alignment:
| Q |
50 |
agtgcatgcactccaaacacattggttccttaaaccattttatg |
93 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| || |||||||| |
|
|
| T |
3288136 |
agtgcatgcactccaaacaccttgattccttacactattttatg |
3288093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University