View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5682-27 (Length: 127)
Name: Solexa-NF5682-27
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5682-27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 7 - 123
Target Start/End: Complemental strand, 40652894 - 40652776
Alignment:
| Q |
7 |
agaacatttcaatgtagctatcacgaaattgtcaacaaaaaataaatgtagctatcacgaatgga--nnnnnnnaaaaataatctaattgagtgtattta |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40652894 |
agaacatttcaatgcagctatcacgaaattgtcaacaaaaaataaatgtagctatcacgaatggattttttttttaaaataatctaattgagtgtattta |
40652795 |
T |
 |
| Q |
105 |
agaattcgttcgaaccata |
123 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
40652794 |
agaattcgttcaaaccata |
40652776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University