View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5682-29 (Length: 125)
Name: Solexa-NF5682-29
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5682-29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 3 - 115
Target Start/End: Original strand, 13137407 - 13137519
Alignment:
| Q |
3 |
atgaaccgataaaaagggaaaagagaaacagttttcataaacaataaacaatagatgttttcagcatcaacatatttgagatggaccaagaccaataaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13137407 |
atgaaccgataaaaagggaaaagagaaacagttttcataaacaataaacaatagatgttttcagcatcaacatatttgagatggaccaggaccaataaaa |
13137506 |
T |
|
| Q |
103 |
aattaaaattcat |
115 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13137507 |
aattaaaattcat |
13137519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University