View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5682-37 (Length: 89)
Name: Solexa-NF5682-37
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5682-37 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 4e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 5 - 89
Target Start/End: Original strand, 41805189 - 41805273
Alignment:
| Q |
5 |
ggccgctgacaatgaagcttttcatgaaactatcacaagtactaaagagtggttcaacagtgtgatatctggaatcgatactgta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41805189 |
ggccgctgacaatgaagcttttcatgaaactatcacaagtactaaagagtggttcaacagtgtgatatctggaatcgatactgta |
41805273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 41812017 - 41812093
Alignment:
| Q |
10 |
ctgacaatgaagcttttcatgaaactatcacaagtactaaagagtggttcaacagtgtgatatctggaatcgatact |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||| |||||||| |||||||||| || |||||| |
|
|
| T |
41812017 |
ctgacaatgaagcttttcatgaaactatcacaagtattaaaaagtgtgtcaacagtatgatatctgggatagatact |
41812093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 41798798 - 41798877
Alignment:
| Q |
7 |
ccgctgacaatgaagcttttcatgaaactatcacaagtactaaagagtggttcaacagtgtgatatctggaatcgatact |
86 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||| || |||||| |
|
|
| T |
41798798 |
ccgctaacaatgaagcttttcatgaaactatcacaagtgttaaagtgtgtgtcaacagtgtgatatctgggatagatact |
41798877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University