View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-12 (Length: 143)
Name: Solexa-NF5684-12
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 4 - 143
Target Start/End: Original strand, 1599230 - 1599372
Alignment:
| Q |
4 |
atgaaggttgaatgtaggttctgtggtttcaaatcgaataggaattatc---ttttccaaaaccgaactgtacttttcttgtggaaatctccaatgcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1599230 |
atgaaggttgaatgtaggttctgtggtttcaaatcgaataggaattatcatcttttccaaaaccgaactgtacttttcttgtggaaatctccaatgcaag |
1599329 |
T |
|
| Q |
101 |
tggaaatcatcaatacaacaagaaatatttattatacattatc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1599330 |
tggaaatcatcaatacaacaagaaatatttattatacattatc |
1599372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 41222434 - 41222373
Alignment:
| Q |
16 |
tgtaggttctgtggtttcaaatcgaataggaattatcttttccaaaaccgaactgtactttt |
77 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| ||| ||||| ||| || || ||||||||| |
|
|
| T |
41222434 |
tgtaggttatgtggtttcaaaccgaataggaactatattttcaaaacccaaattgtactttt |
41222373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University