View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-13 (Length: 147)
Name: Solexa-NF5684-13
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 14 - 147
Target Start/End: Original strand, 5526879 - 5527012
Alignment:
| Q |
14 |
tagtgattttagtgcatgttcactagatttgctaaaataatgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526879 |
tagtaattttagtgcatgttcactagatttgctaaaataacgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
5526978 |
T |
 |
| Q |
114 |
taattcattatatttcgttgtttcacattgatta |
147 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |
|
|
| T |
5526979 |
taattcattagatttcgttgtttcacattcatta |
5527012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University