View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-19 (Length: 188)
Name: Solexa-NF5684-19
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 2e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 2e-81
Query Start/End: Original strand, 2 - 188
Target Start/End: Original strand, 28885261 - 28885446
Alignment:
| Q |
2 |
ataggggggtgtattgaccgcyttcgccgcagccgtwgagtngkamcatagggaagctacacggtgaaggtgtccttcgaatcttcgattgttttagagt |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| | | |||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
28885261 |
ataggggggtgtattgaccgctttcgccgcagccgttgagt-ggaccatagggaagctacacggtgaaggtgtccttcgaatcttcgattgtttaaggtt |
28885359 |
T |
 |
| Q |
102 |
gtgtggagagcatttagcgtaaaacaaaaccaaagtcttggtacaagtgagggtacacaccatcaagatattatacaataccaatta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
28885360 |
gtgtggagagcatttagcgtaaaacaaaaccaaagtcttggtacaagtgagggtacacaccatcaagatactatccaataccaatta |
28885446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University