View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-22 (Length: 142)
Name: Solexa-NF5684-22
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 6e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 6e-72
Query Start/End: Original strand, 2 - 142
Target Start/End: Complemental strand, 2360905 - 2360765
Alignment:
| Q |
2 |
cagagagcatgttctatggtgatattggttttgagtatttcgattttgggttagaaagcttgcagacacataaggatgaagacttttttcaagatattga |
101 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2360905 |
cagagagcatgttatatggtgatattggttttgagtatttcgattttgggttagaaagcttgcagacacataaggatgaagacttttttcaagatattga |
2360806 |
T |
 |
| Q |
102 |
tgatttatttgcttcagatactactgttcttgctctttaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2360805 |
tgatttatttgcttcagatactactgttcttgctctttaat |
2360765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University