View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-25 (Length: 134)
Name: Solexa-NF5684-25
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 7376228 - 7376101
Alignment:
| Q |
8 |
gattataggattggtttagttgttagtagtccataaggtggaaa--gccaaagaagcagtgaattatattttccccttgttgactcttacattgttcttc |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7376228 |
gattataggattggtttagt-gttagtagtccataaggtggaaaaagccaaagaagcagtgaattatattttccccttgttgactcttacattgttcttc |
7376130 |
T |
|
| Q |
106 |
atatatgattattagtagaagttcaacaa |
134 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
7376129 |
atatatgattattagtagaaggtcaacaa |
7376101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University