View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-31 (Length: 133)
Name: Solexa-NF5684-31
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-31 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 8 - 133
Target Start/End: Complemental strand, 39662244 - 39662119
Alignment:
| Q |
8 |
cttctctcatatttctccttataaaaaagccagctcgtgcaattctcttacccttttgttttgctctctcgctcgtaatcgaacaatctcatcctcacag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39662244 |
cttctctcatatttctccttataaaaaagccagctcgtgcaattctcttacccttttgttttgctctctcgctcgtaatcgaacaatctcatcctcacag |
39662145 |
T |
 |
| Q |
108 |
tttcgtattcttcccgatctcaccac |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39662144 |
tttcgtattcttcccgatctcaccac |
39662119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 22596164 - 22596208
Alignment:
| Q |
89 |
aacaatctcatcctcacagtttcgtattcttcccgatctcaccac |
133 |
Q |
| |
|
||||||||| ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
22596164 |
aacaatctcctcctcacagtttcattttcttctcgatctcaccac |
22596208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University