View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-32 (Length: 127)
Name: Solexa-NF5684-32
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 28885668 - 28885549
Alignment:
| Q |
8 |
gtagcagcgtgaatgtctaagaaatgaatatgcttgagctaactgaatattcacttaaactttcctacaaaacaaggagaaaatttctagttttttccaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28885668 |
gtagcagcgtgaatgtctaagaaatgaatatgcttgagctaactgaatattcacttaaactttcctacaaaacaaggagaaaatttctagttttttccaa |
28885569 |
T |
|
| Q |
108 |
ctctttcagtgagaactatg |
127 |
Q |
| |
|
|||||||| | ||||||||| |
|
|
| T |
28885568 |
ctctttcacttagaactatg |
28885549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University