View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-35 (Length: 127)
Name: Solexa-NF5684-35
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-35 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 3e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 9 - 127
Target Start/End: Original strand, 4560265 - 4560383
Alignment:
| Q |
9 |
ctttgaattcaaatgctttcaaatcaatctatgcaacaagaagctgacaaagtagtgcagagaaattttataaacgagctaaagaagaatataaatttaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4560265 |
ctttgaattcaaatgctttcaaatcaatctatgcaacaagaagctgacaaagtagtgcagagaaattttataaacgagctaaagaagaatataaatttaa |
4560364 |
T |
|
| Q |
109 |
tattattatgattttgaag |
127 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4560365 |
tattattatgattttgaag |
4560383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 123
Target Start/End: Original strand, 4573957 - 4574073
Alignment:
| Q |
7 |
acctttgaattcaaatgctttcaaatcaatctatgcaacaagaagctgacaaagtagtgcagagaaattttataaacgagctaaagaagaatataaattt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| || | |||||||||||||||| | |
|
|
| T |
4573957 |
acctttgaattcaaatgctttcaaatcaatctatgcaaccagaagctgacaatgtagtgcagagaaattttataaaagatcaaaagaagaatataaatat |
4574056 |
T |
|
| Q |
107 |
aatattattatgatttt |
123 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
4574057 |
aatattaatatgatttt |
4574073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 25 - 72
Target Start/End: Original strand, 4567994 - 4568041
Alignment:
| Q |
25 |
tttcaaatcaatctatgcaacaagaagctgacaaagtagtgcagagaa |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
4567994 |
tttcaaatcaatctatgcaacaagaagctgatagtgtagtgcagagaa |
4568041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University