View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-36 (Length: 122)
Name: Solexa-NF5684-36
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-36 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 1478863 - 1478977
Alignment:
| Q |
8 |
attgtttcagccaaagatgaagaagcatgataatagcattaaacacatagatttgattagtaaaataaaagaatttagccatcaatttcgtttaacatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1478863 |
attgtttcagccaaagatgaagaagcatgataatagcattaaacacatagatttgattagtaaaataaaagaatttagccatcaatttcgtttaacatta |
1478962 |
T |
|
| Q |
108 |
gctggtttatagttg |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1478963 |
gctggtttatagttg |
1478977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 41 - 77
Target Start/End: Original strand, 18289918 - 18289954
Alignment:
| Q |
41 |
tagcattaaacacatagatttgattagtaaaataaaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18289918 |
tagcattaaacacatagatttgattagtaaaataaaa |
18289954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University