View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-37 (Length: 121)
Name: Solexa-NF5684-37
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-37 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 9954510 - 9954397
Alignment:
| Q |
8 |
aaatatccaacacaccacaaacaattccatgagttgacgtgtatattcccacacacgttggattggcagaagggtctcggattaacgttaacatgctata |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
9954510 |
aaatatccaacgcaccacaaacaattccatgagttgacgtgtatatccccacacacgttggattggcagaagggtcgcggattaacattaacatgctata |
9954411 |
T |
|
| Q |
108 |
taagatgaaacaaa |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9954410 |
taagatgaaacaaa |
9954397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University