View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-38 (Length: 123)
Name: Solexa-NF5684-38
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-38 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 3439195 - 3439080
Alignment:
| Q |
8 |
gtatataccgtgttcgacattagaaagtggaagattttgtattgacatgagtttaagtgaagcttgcatggataaacatatatggttaataagatctatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3439195 |
gtatataccgtgttcgacattagaaagtggaagattttgtattgacatgagtttaagtgaagcttgcatggataaacatatatggttaataagctctatt |
3439096 |
T |
|
| Q |
108 |
cttaaactatatttat |
123 |
Q |
| |
|
||| ||||| |||||| |
|
|
| T |
3439095 |
cttgaactagatttat |
3439080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 59 - 96
Target Start/End: Complemental strand, 1477102 - 1477065
Alignment:
| Q |
59 |
tttaagtgaagcttgcatggataaacatatatggttaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
1477102 |
tttaagtgaagcttgcatggataaacatctttggttaa |
1477065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 11 - 116
Target Start/End: Complemental strand, 18288172 - 18288067
Alignment:
| Q |
11 |
tataccgtgttcgacattagaaagtggaagattttgtattgacatgagtttaagtgaagcttgcatggataaacatatatggttaataagatctattctt |
110 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||||| |||| ||| ||||||||||||||||||||||||||||| ||||||| ||| |||| |||| |
|
|
| T |
18288172 |
tataccgtgttcaacattagaaaatagaagattttgttttgagatgggtttaagtgaagcttgcatggataaacatcgttggttaagaagctctaatctt |
18288073 |
T |
|
| Q |
111 |
aaacta |
116 |
Q |
| |
|
||||| |
|
|
| T |
18288072 |
gaacta |
18288067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University