View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-43 (Length: 91)
Name: Solexa-NF5684-43
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-43 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 37833930 - 37833847
Alignment:
| Q |
8 |
gtggatgctgacaaggaatccttcacaaagtatcacgagctgttgttgaaattggtgaaggagggtggaataattgcatatgac |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37833930 |
gtggatgctgacaaggaatccttcacaaagtatcacgagctgttgttgaaattggtgaagaagggtggaataattgcatatgac |
37833847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 15 - 87
Target Start/End: Complemental strand, 37825698 - 37825623
Alignment:
| Q |
15 |
ctgacaaggaatccttcacaaagtatcacgagctgttgttgaaattggtgaaggag---ggtggaataattgcata |
87 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||| |||| |||||||||| || ||||| ||||||||||| |
|
|
| T |
37825698 |
ctgacaaggaaaacttcacaaaatatcaggagctgttattgacattggtgaagaagctaggtgggataattgcata |
37825623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University