View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-51 (Length: 122)
Name: Solexa-NF5684-51
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-51 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 9e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 9e-40
Query Start/End: Original strand, 5 - 122
Target Start/End: Complemental strand, 30081231 - 30081107
Alignment:
| Q |
5 |
aagaagcaaattaagacggacagt-------ctgaactggtgtttttattactcagttcagttcacttcatgaactgtcgatcaaaattcagctttctcg |
97 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
30081231 |
aagaagcaaattatgacggacagttcaagaactgaactggtgtttttattactcagttcagttcaattcatgaactgtcgatcaaaattcagttttctcg |
30081132 |
T |
|
| Q |
98 |
gtgcggtgcagttttgtttaatagt |
122 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
30081131 |
gtgcggtgcagtttggtttaatagt |
30081107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University