View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5684-8 (Length: 151)
Name: Solexa-NF5684-8
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5684-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 9 - 149
Target Start/End: Original strand, 1599022 - 1599163
Alignment:
| Q |
9 |
gagatgaacaaaatatcatgtagtgtcttttattgtgtggttggtgttaatatgactatgtgtcaaaagctgtcatcagt---gtcatgcttaaaatccg |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
1599022 |
gagataaacaaaatatcatgtagtgtcttttattgtgtggttggtgttaatatgactatgtgtc--aagctgtcatcagtgtcgtcatgcttaaaatccg |
1599119 |
T |
|
| Q |
106 |
aaactaggactgtttatggttcatttcatgaggaaaatcaaatt |
149 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1599120 |
aaactaggactgtttatggttcgtttcatgaggaaaatcaaatt |
1599163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 9e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 9e-22
Query Start/End: Original strand, 22 - 149
Target Start/End: Complemental strand, 41222627 - 41222502
Alignment:
| Q |
22 |
tatcatgtagtgtcttttattgtgtggttggtgttaatatgactatgtgtcaaaagctgtcatcagtgtcatgcttaaaatccgaaactaggactgttta |
121 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||| |||| || | || || ||||||||| ||||||| ||| |||||||||| ||| | |
|
|
| T |
41222627 |
tatcttgtattgtcttttattgtgtggttggtgttaatatgaccatgtttc--atgccgttatcagtgtcgtgcttaatatctaaaactaggaccgttca |
41222530 |
T |
|
| Q |
122 |
tggttcatttcatgaggaaaatcaaatt |
149 |
Q |
| |
|
|||||| ||||| || |||||||||||| |
|
|
| T |
41222529 |
tggttcgtttcaagaagaaaatcaaatt |
41222502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University