View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5700-13 (Length: 131)
Name: Solexa-NF5700-13
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5700-13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 1e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 11 - 56
Target Start/End: Original strand, 10926457 - 10926502
Alignment:
| Q |
11 |
atgaacaatgattttgaactgttttgtttgctcaatttgaatgaat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10926457 |
atgaacaatgattttgaactgttttgtttgctcaatttgaatgaat |
10926502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 10926554 - 10926601
Alignment:
| Q |
57 |
tatttgattgttaatcttaacctctgtagcatcgacacatctaatcga |
104 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
10926554 |
tatttgatttttaatcttaacctctgtatcatggacacatctaatcga |
10926601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University