View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5700-15 (Length: 127)
Name: Solexa-NF5700-15
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5700-15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 7 - 127
Target Start/End: Complemental strand, 30190188 - 30190068
Alignment:
| Q |
7 |
agagacatggattatttttaattgggggacaatggaggatcaaattatgccatcagttcaatatttacacaattttgtacaactaattgtgtaatgcagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30190188 |
agagacatggattatttttaattgggggacaagggaggatcaaattatgccatcacttcaatatttacacaattttgtataactaattgtgtaatgcagc |
30190089 |
T |
 |
| Q |
107 |
tgacatctaagctgattattc |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30190088 |
tgacatctaagctgattattc |
30190068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University