View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5700-5 (Length: 235)
Name: Solexa-NF5700-5
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5700-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 28778038 - 28777813
Alignment:
| Q |
10 |
atgaactacacagttaatttgttaaaagcttttggagttaaaattactatgtcggtagcgattgttgaatttcgatctttgtatttatctagcagtgtca |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28778038 |
atgaactacacagtaaatttgttaaaagcttttggagttaaaattactatgttggtagcaattgttgaatttcgatctttgtatttatctagcagtgtca |
28777939 |
T |
 |
| Q |
110 |
gtctgaaacaaggcaaggtttttcttgtaattgattcttgtttgtgtgttttgtaagatttgagcagtgtaaaaggttttcttattgtttgttgaccttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28777938 |
gtctgaaacaaggcaaggtttttcttgtaattgattcttgtttgtgtgttttgtaagatttgagcagtgtaaaaggttttcttattgtttgttgaccttc |
28777839 |
T |
 |
| Q |
210 |
taggtatatgaagtactcaaattgct |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28777838 |
taggtatatgaagtactcaaattgct |
28777813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University