View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5700-6 (Length: 176)
Name: Solexa-NF5700-6
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5700-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 5e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 5e-70
Query Start/End: Original strand, 7 - 156
Target Start/End: Complemental strand, 3691803 - 3691654
Alignment:
| Q |
7 |
acttgccacatgtaaaactatttcttttctttagaattttcttctgctatagaatctcacctcttctgcaacaagagaatctagatcctgtcattaattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
3691803 |
acttgccacatgtaaaactatttcttttctttagaattttcttctgctatagaatctcacctcttctgcaacaagagaatctagattcagtcataaattt |
3691704 |
T |
|
| Q |
107 |
agagaaagtcaacacctcatatcttagttatagctttgcaaatagagatc |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3691703 |
agagaaagtcaacacttcatatcttagttatagctttgcaaatagagatc |
3691654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University